You are here
Home > Cancer

Download PDF by George F. Vande Woude (ed.), George Klein (ed.): Advances in Cancer Research, Vol. 108

By George F. Vande Woude (ed.), George Klein (ed.)

ISBN-10: 012380888X

ISBN-13: 9780123808882

Offers worthwhile info at the intriguing and fast-moving box of melanoma research. Outstanding and unique studies are offered on a number of themes.

Show description

Read or Download Advances in Cancer Research, Vol. 108 PDF

Best cancer books

New PDF release: I Am Not My Breast Cancer: Women Talk Openly About Love and

''I am no longer my breast, and i'm no longer melanoma; they're merely items of who i'm. what's my middle like, am I variety, robust, loving, compassionate. . . . these are the issues that count number. '' i'm really not My Breast melanoma gathers the nice and cozy, loving, frank, and educated voices of greater than 800 women—from each nation within the state and from continents as far-off as Australia and Africa—who exhibit their fears, exchange recommendation, proportion stories, and exhibit their inner most, such a lot intimate matters.

Cox-2: a new target for cancer prevention and treatment by Joseph R. Bertino, Andrew J. Dannenberg, Raymond N. DuBois PDF

Quite a few investigators have discovered elevated degrees of cyclooxygenase-2 (COX-2) in either pre-malignant and malignant tissues. additionally, animals engineered to be COX-2 poor or taken care of with a selective COX-2 inhibitor confirmed lowered tumor formation and development. the current publication reports those findings suggesting that COX-2 is a sound molecular goal for the prevention and remedy of melanoma.

The Hippo Signaling Pathway and Cancer - download pdf or read online

​​The Hippo signaling pathway is speedily gaining reputation as an incredible participant in organ dimension keep watch over and tumorigenesis, and lots of best scientists are displaying elevated curiosity during this becoming box and it really is relation to melanoma. The chapters during this quantity conceal almost all points of tumor biology, simply because individuals of the Hippo Pathway were linked to a variety of well-established cellphone signaling pathways, simply to identify a number of; Ras, Wnt, TGFbeta and p53.

Download e-book for kindle: Interleukins in cancer biology : their heterogeneous role by Arseniy Yuzhalin, Anton Kutikhin

Interleukins in melanoma Biology responds to the transforming into want for credible and up to date information regarding the impression of interleukins on prevalence, improvement and development of melanoma. It presents trustworthy information regarding all identified interleukins (38), describes contemporary discoveries within the box, and in addition, indicates additional instructions of analysis at the such a lot promising points of this subject.

Extra info for Advances in Cancer Research, Vol. 108

Sample text

These factors are found to act synergistically to induce disease progression and increased risk of cirrhosis and HCC (Table I). Table I Factors Associated with the Development of Hepatocellular Carcinoma in Patients with Chronic Hepatitis B Virus Infection Virus Persistently high HBV replication Genotype (C > B, D > A) Specific HBV mutants (core promoter mutant, pre-S deletion) Host Male gender Advanced age or longer duration of infection Presence of cirrhosis Family history of HCC Ethnicity (Asian, African > Caucasian) Genetic alteration Diabetes mellitus Obesity Hepatic steatosis Repeated hepatitis flare Environmental Concurrent HCV, HDV, or HIV infection Alcohol drinking Cigarette smoking Aflatoxin exposure Betel nut chewing HCC, hepatocellular carcinoma; HBV, hepatitis B virus; HCV, hepatitis C virus; HDV, hepatitis D virus; HIV, human immunodeficiency virus.

02). In addition, the prevalence of BCP A1762T/ G1764A mutant was higher in HCC patients with genotypes B and C. , 2006). Taking these lines of evidence together, BCP A1762T/G1764A mutation seems to play an important role in the pathogenesis of liver disease progression and serves as the strongest viral factor associated with HCC risk in HBV carriers. The biological mechanisms involved in BCP A1762T/G1764A mutationrelated hepatocarcinogenesis remain to be established. , 2008). In contrast, the promoter activity of HBV strains isolated from HCC patients was increased when 1762T and 1764A are reversely mutated into 1762A and 1764G, respectively.

Taken together, a dual change of A1762T/ G1764A in BCP will not only diminish the production of HBeAg, enhance viral replication and lead to increased host immune response but also induce an amino acid change in the X protein to promote hepatocarcinogenesis. Clinically, the role of precore G1896A stop codon mutation in disease progression remains debatable. , 2008) showed precore G1896A stop codon mutation may reduce the risk of HCC in HBV carriers (Table III). 37 Recent Advances in the Research of Hepatitis B 1613 1849 Core promoter Upstream regulatory region Basal core promoter 1742 Enhancer II 1627 1774 Box a 1644 Box b 1666 1701 1713 1653 GTCTTACATAAGACGACTCT 1752/1753 1762/1764/1766 GATTAGGTTAAAGGTCTTT C V I T HB-X protein L H K H94Y R T L K A G V I127N/S/T K130M V131I Fig.

Download PDF sample

Advances in Cancer Research, Vol. 108 by George F. Vande Woude (ed.), George Klein (ed.)


by Mark
4.5

Rated 4.84 of 5 – based on 25 votes
Top